A teen stablehand who cheated death after a horrific high-speed fall left her waking from a coma in a “vegetative state” is ...
"With every step we took, we held on and prayed we would make it through to the next one," Alicia Claytor, 35, told Newsweek.
A Staffordshire man was left with permanent brain damage after a giant metal bar smashed onto his head while at work - leaving him and his wife surviving on just £1,300 a month. Electrician Mark ...
Things continue to trend in the right direction for Brian Foster after his serious car accident May 1.
Mark Ludlow, 63, was assisting a colleague on a broken lift at a Staffordshire factory when a giant metal rod dropped and ...
Stories by SWNS on MSN
Man surviving on £1.3k a month after metal bar struck his face
A man was left with permanent brain damage after a giant metal bar smashed onto his head while at work – leaving him and his ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Hereditary axonal peripheral neuropathies comprise a genetically heterogeneous group of disorders that are clinically subsumed under the name of Charcot–Marie–Tooth (CMT) disease type 2 (CMT2).
Some results have been hidden because they may be inaccessible to you
Show inaccessible results